شنبه ۲۶ اسفند ۱۳۹۶ - ۰۹:۵۶

برگزاری آخرین جلسه آموزشی درمانگاه با موضوع DNA

فریزدی

بنابرگزارش مفداایران، آخرین جلسه آموزشی درمانگاه معاونت فرهنگی و دانشجویی دانشگاه ایران روز سه شنبه ۲۲ اسفندماه در محل درمانگاه با حضور علاقمندان این دوره آموزشی برگزار شد.

در این جلسه آموزشی آقای سینا فر یزدی درخصوص رشته‌های پروتئینی بنام DNA در هسته سلول جانداران که عامل وراثت صفات مختلف هر موجود زنده محسوب می‌گردد، مباحثی عنوان نمود که خلاصه‌ای از آن بدین شرح است:

 DNA : دئوکسی ریبونوکلیک اسید – ماده ژنتیکی داخل هسته سلول 

ژن : توالی خاصی از DNA  دورشته‌ای که یک صفت را کد می‌کند مثل رنگ چشم – تولید یک پروتئین خاص

تقسیمات سلولی به دوشکل میتوز (سوماتیک) و میوز (جنسی) صورت می‌گیرد. در مرحله متافاز تقسیم سلولی کروموزوم‌ها به بیشترین تراکم خود می‌رسند که آنها را براساس تعداد، اندازه، شکل و موقعیت سانترومر مرتب می‌کنند به تکنیک فوق اصطلاحاً کاریوتیپ می‌گویند.

شبیه سازی (کلونینگ): اولین شبیه سازی جهت تولید یک گوسفند در سال ۱۹۹۶ انجام گرفت. برای این منظور یک سلول از پستان گوسفند ماده جدا کردند. سپس این سلول را به تخمک بارور نشده گوسفند دیگری الحاق کردند. پیش از این، کلیه مواد ژنتیکی این تخمک خارج شده بود. سلول‌های الحاقی رشد و نمو یافتند و به جنین تبدیل شدند. سپس این جنین در رحم گوسفند سومی قرار گرفت و پس از حدود پنج ماه بدنیا آمد.

انواع بیماری‌های شایع ژنتیکی:

اتوزومی غالب : هانتینگتون – استئوژنزایمپرفکتا –  شارکو ماری توت

اتوزومی مغلوب : هموکروماتوز –  فنیل کتونوریا – تالاسمی –  فیبروزسیستیک – آلبینیسم

وابسته به X غالب: سندرم X شکننده –  سندروم Rett

وابسته به X مغلوب: کوررنگی -  دیستروفی عضلانی دوشن – هموفیلی

بیماریهای ژنتیکی مربوط به حذف یا اضافه شدن قسمتی از کروموزوم : آنجلمن – پرادرویلی – فریاد گربه – داون – ادوارد – کلاین فلتر -  جاکوب

تشخیص هویت به روش DNA fingerprinting :

DNA  از ۴ جفت باز تشکیل شده است (آدنین، سیتوزین، گوانین و تیمین). اگر DNA  یک کروموزوم سالم را باز کنیم؛ یک رشته بسیار طویلی از ۴ باز را خواهیم دید. در طول این رشته بسیار طویل مناطقی وجود دارند که ممکن است چند باز ،چندین بار تکرار شوند (مانند GAACGAACGAACGAACGAACGAAC ) که می بینیم GAAC چندین بار تکرار شده است. این تکرار ها در طول کروموزوم‌های هر فرد به صورت انحصاری وجود دارد و مانند اثر انگشت منحصر به فرد هستند. در آزمایشگاه ابتدا قطعات DNA حاصل از هضم DNA توسط آنزیم‌های محدود کننده بر اساس اندازه، با روش الکتروفورز بر روی ژل آگارز جدا می‌گردند. قطعات کوچکتر DNA سریعتر از قطعات بزرگتر حرکت می‌کنند و این امر سبب تفکیک قطعات بصورت باندهای مجزا بر روی ژل می‌شود. مولکولهای اسید نوکلئیک رادیواکتیویته بعنوان پروب افزوده می‌شوند تا با قطعات DNA مکمل پیوند یافته و امکان عکس برداری از الگوی توزیع باندها که تحت عنوان DNA Fingerprint  نامیده می‌شود فراهم گردد

ارسال نظر

    • نظرات حاوی توهین و هرگونه نسبت ناروا به اشخاص حقیقی و حقوقی منتشر نمی‌شود.
    • نظراتی که غیر از زبان فارسی یا غیر مرتبط با خبر باشد منتشر نمی‌شود.
شما در حال ارسال پاسخ به نظر « » می‌باشید.